circad | circRNAs associated with diseases

hsa_circ_0068871
Gene	FGFR3	Organism	Human
Genome Locus	chr4:1801473-1804791:+	Build	hg19
Disease	Bladder Cancer	ICD-10	Malignant neoplasm of Bladder, unspecified (C67.9)
DBLink	Link to database	PMID	30999937
Experimental Method
Sample Type	Tissue and cell lines	Comparison	BCa and adjacent normal tissue specimens were collected from 32 patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGAGTACCTCTGTCGAGCCA Reverse TGTGTCCACACCTGTGTCCT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Mao, W, Huang, X, Wang, L, Zhang, Z, Liu, M, Li, Y, Luo, M, Yao, X, Fan, J, Geng, J (2019). Circular RNA hsa_circ_0068871 regulates FGFR3 expression and activates STAT3 by targeting miR-181a-5p to promote bladder cancer progression. J. Exp. Clin. Cancer Res., 38, 1:169.